Nueva prueba de PCR anidada apunta a un gen específico para el patógeno EHP de camarón cultivado

Jee Eun Han, DVM, Ph.D. Kathy F.J. Tang, Ph.D. Ji Hyung Kim, Ph.D.

Para diagnósticos de rutina y detección de infecciones de bajo grado

el patógeno EHP
Este estudio desarrolló un método de PCR anidado que utiliza secuencias de genes de β-tubulina que son específicas de EHP y se pueden usar en diagnósticos de rutina.

El microsporidio Enterocytozoon hepatopenaei(EHP) infecta a los camarones peneidos y se ha considerado una amenaza crítica para la acuacultura del camarón, causando graves pérdidas económicas en las granjas camaroneras de varios países asiáticos. Los órganos diana incluyen el hepatopáncreas y el intestino medio, por lo que la infección por EHP puede afectar la función digestiva y de absorción, lo que produce un retraso en el crecimiento. Los camarones podrían infectarse con EHP por canibalismo o alimentándose de alimentos vivos contaminados con EHP.

Métodos de diagnóstico de EHP dirigidos a la secuencia SSU ARNr

Se han desarrollado varios métodos de diagnóstico de EHP basados ​​en la subunidad pequeña (SSU) ARNr, incluyendo PCR, qPCR, hibridación in situy ensayos de amplificación isotérmica mediada por vuelta. Sin embargo, las secuencias SSU ARNr no son muy específicas para la detección de microsporidios y los métodos de PCR basados ​​en el SSU ARNr pueden generar falsos positivos en muestras que no son de camarón. Por ejemplo, la secuencia del SSU ARNr de EHP compartió una similitud del 90 por ciento con la de Enterospora cancerique infecta a los cangrejos marinos. Por lo tanto, se necesita un método de PCR más específico para los diagnósticos de EHP.

Nuevo método de diagnóstico de EHP dirigido al gen de β-tubulina de EHP

En consecuencia, desarrollamos un nuevo método de diagnóstico de EHP con dos conjuntos de cebadores diseñados en base a la secuencia del gen de la β-tubulina (GenBank No. KX842357, Tabla 1).

Han, detección de EHP, Tabla 1

Nombre del cebador Secuencia (5’ to 3’) Tamaño de amplicón (bp)
β-tubulina 1er-paso PCR
EHP-618F CAGCTGGTTGAAAATGCAAA 618
EHP-618R GTGCAAAAATGCCTTTCGTT 618
β-tubulina 2do-paso PCR (anidado)
EHP-237F GATATGCGCCTCTGTGTTCA 237
EHP-237R TGTTTGGAATCCACTCGACA 237

Tabla 1. Cebadores de PCR utilizados para la detección de Enterocytozoon hepatopenaei (EHP).

Se realizó una PCR de primer paso con los cebadores EHP-618F/R en las siguientes condiciones de ciclado: desnaturalización inicial a 94 grados-C durante 3 minutos, seguido de 35 ciclos de 94 grados-C durante 30 segundos, 58 grados-C durante 30 segundos y 72 grados-C durante 30 segundos, y una extensión final a 72 grados-C durante 7 minutos.

Luego, se realizó una PCR (anidada) de segundo paso con los cebadores internos EHP-237F/R en las siguientes condiciones de ciclado: desnaturalización inicial a 94 grados-C durante 3 minutos, seguido de 20 ciclos de 94 grados-C para 30 segundos, 58 grados-C durante 30 segundos y 72 grados-C durante 30 segundos, y una extensión final a 72 grados-C durante 7 minutos.

La PCR de segundo paso (anidada) es 100 veces más sensible que la PCR de primer paso (Fig. 1) y, por lo tanto, es adecuada para detectar una infección de EHP de bajo nivel.

Fig. 1: Comparación de sensibilidad entre el primer paso y el segundo paso (anidado) de PCR determinada por una dilución de 10 veces (de 10-1 a 10−5) de ADN positivo a EHP a una concentración inicial de 100 ng/μl.

Estudio de muestras de campo – ensayo de PCR de primer paso

Para comparar la sensibilidad en muestras de campo, aplicamos varias muestras de camarón infectadas con EHP (n = 22) recolectadas de países del sudeste asiático (Vietnam, India, Tailandia e Indonesia) y de camarón de salmuera artemia spp. positiva para EHP (n = 6; todos en la etapa adulta) determinado por una PCR de SSU ARNu de EHP (los productos de PCR corresponden al no. de acceso KP759285) al ensayo de PCR de primer paso. Después de la primera etapa de la PCR, se generaron amplicones de 618 pb a partir de todas las muestras de EHP (n = 22) de varias granjas de camarones en los países mencionados anteriormente (Fig. 2).

Fig. 2: Amplicones representativos generados por los ensayos de PCR de primer paso dirigidos al gen de la β-tubulina. Amplicones de 618 pb de muestras de la India, Vietnam y Tailandia, pero los amplicones no se generaron a partir de muestras de artemia spp. por PCR de primer paso.

El ensayo de PCR de primer paso es simple y rápido. Sin embargo, no generó ningún amplicón a partir de las muestras de biomasa de artemia EHP positiva (n = 6), lo que podría deberse a las bajas cantidades de EHP presentes en estas muestras (Fig. 2).

Estudio de muestras de campo – ensayo de PCR de segundo paso (anidado) 

Fig. 3: Amplicones representativos generados por los ensayos de PCR de segundo paso (anidados) dirigidos al gen de la β-tubulina. Amplicones de 237 pb de muestras de artemia EHP positiva.

Después de la PCR (anidada) de segundo paso, se observó un fragmento de ADN de 237 bp en todas las muestras de EHP (n = 22), incluidas las de las muestras de biomasa de artemia (Fig. 3). Los resultados diagnósticos obtenidos por este método de PCR anidado son beneficiosos para el monitoreo de camarones con bajos niveles de infección por EHP. Además, este método es útil para detectar EHP en alimentos en vivo (como la artemia), que es importante en el campo porque los alimentos en vivo son un riesgo potencial de infección por EHP.

Perspectivas

En este estudio, desarrollamos un método de PCR anidado utilizando secuencias de genes de β-tubulina. Este nuevo método de PCR es específico al EHP y se puede utilizar en diagnósticos de rutina. Además, este método es útil para detectar una infección por EHP de bajo grado. Además, detectamos EHP en muestras de artemia mediante este método de PCR anidado. Sugiere la posibilidad de transferencia de EHP desde alimentos en vivo a los reproductores de camarón. En el campo, los camarones podrían infectarse con EHP alimentándose de alimentos vivos contaminados con EHP, como la artemia. Se requieren experimentos de laboratorio adicionales para determinar la infectividad de la artemia infectada por EHP en camarones.


Now that you've finished reading the article...

… we hope you’ll consider supporting our mission to document the evolution of the global aquaculture industry and share our vast network of contributors’ expansive knowledge every week.

By becoming a Global Aquaculture Alliance member, you’re ensuring that all of the 
pre-competitive work we do through member benefits, resources and events
 (The Academy, The Advocate, GAA Films, GOAL, MyGAA) can continue. An individual membership costs just $50 a year.

Support GAA and Become a Member

  • Jee Eun Han, DVM, Ph.D.

    Jee Eun Han, DVM, Ph.D.

    Laboratory of Aquatic Biomedicine
    College of Veterinary Medicine
    Kyungpook National University
    Daegu 41566, Korea

    [32,109,111,99,46,108,105,97,109,103,64,51,50,50,49,101,106,110,97,104]

  • Kathy F.J. Tang, Ph.D.

    Kathy F.J. Tang, Ph.D.

    Yellow Sea Fisheries Research Institute
    Chinese Academy of Fishery Sciences
    Qingdao 266071, China

  • Ji Hyung Kim, Ph.D.

    Ji Hyung Kim, Ph.D.

    Infectious Disease Research Center
    Korea Research Institute of Bioscience and Biotechnology
    Daejeon 34141, Republic of Korea